CreloAI LogoCreloAI

AI-Powered Campaigns That Actually Convert

Track ROI per influencer. Scale what works. Cut what doesn't.

Brands see up to 36% higher ROI using CreloAI

🚀 Start Your First Campaign
🎁 Your first campaign's free. We only get paid when you win.

Trusted by Thousands

Over + brands $2M+ revenue tracked + creators already work with us to scale influencer campaigns effortlessly.

Reflecting How Leading Brands Use AI to Win

Brand logo
Brand logo
Brand logo
Brand logo
Brand logo
Brand logo
Brand logo
Brand logo
Brand logo
Brand logo
Brand logo
Brand logo
Brand logo
Brand logo

Real Campaign Results (Tracked by CreloAI)

Actual campaign performance from a DTC brand using CreloAI

25

Micro Creators

400K

Total Views

3.5%

Conversion Rate

₹12L

Revenue Generated

📊
PPV Campaign
Pay per view · Auto-track
🎁
Barter Collab
Product exchange · No cash
Full AI Campaign
Brief → launch · Hands-free
Custom Campaign
Any format · Any goal
🛍️
Shopify Store
Sales · Revenue data
📱
FB & Meta Ads
Ad spend · ROAS sync
🎯
924 Creators Matched
AI-vetted · Brand-aligned
🔮
Predicted ROAS 4.2×
AI forecast · Next campaign
📈
Live ROI · ₹3.8L
Real-time · All creators
💸
Auto Payout Done
Instant · Zero manual work

Any campaign type. One AI platform. Brief it in minutes — CreloAI handles the rest.

Grow Revenue in 3 Steps

🔥 Launch

Set up your campaign in minutes. Go live and get noticed instantly.

👀 Viral Reach

80K+ creators see it in real time—your campaign spreads fast.

💰 Instant Earn

Creators post. Engagement happens. Both sides earn immediately.

Your Brand DNA

Understand your brand's personality, audience, and messaging in seconds. Share it on social media or use it to guide your campaigns.

Find your Brand DNA for Free

Campaigns Launching on CreloAI Right Now

Brands are launching AI campaigns and creators are joining every day.

Skincare Brand Campaign

18 creators joined • AI campaign launched

Live

Fitness Apparel Launch

12 creators posting this week

Active

D2C Snack Brand Campaign

35 creators applied

Recruiting

Creators Driving Revenue for Brands

From viral campaigns to high-converting content, our creators help brands earn more, faster.

Creator holding camera, generating content
Creator applying makeup, producing brand content

Real creators. Real paid campaigns. Immediate results. Transparent Spend.

UGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGC

Why Brands Choose CreloAI

AI-Generated Campaign Strategies

CreloAI analyzes thousands of data points — audience fit, historic conversions, engagement integrity — and builds your high-performing campaign strategy in minutes.

Intelligent Creator Matching

Creator selection is based on buyer-likelihood, not follower count — producing an average 37% ROAS lift across CreloAI brand campaigns.

Predictive Revenue Modelling

Forecast revenue, CPA, and ROAS for each creator before you engage — giving you total clarity and control over spend.

CreloAI vs Traditional Agency

Agency
CreloAI
Strategy Delivery Speed
Weeks
Minutes
Creator Vetting
Manual & Biased
AI-Verified
Cost Structure
High Fixed Fees
Affordable Subscription
Predictive ROI
Historical Only
Pre-Launch Projections
TRUSTED RESULTS

Real-World AI Impact

Proven ROI from Real Campaigns (Before vs after using CreloAI)

Ankit C.

Maximized campaign engagement with AI insights

Challenge

Brand struggled to identify the right influencers, leading to low engagement and wasted ad spend.

Solution

Our AI platform matched top-performing influencers with high engagement potential and suggested optimal posting schedules.

Key Results Achieved

2.8% → 7.9%Engagement Rate
45k → 132kCampaign Reach
$12,000 → $38,400ROI

Radhika G.

Streamlined influencer campaigns with AI-driven targeting

Challenge

High cost-per-acquisition due to generic influencer selection and poorly timed posts.

Solution

Implemented predictive AI to identify high-ROI influencers and optimal posting times across channels.

Key Results Achieved

$42 → $19CPA Reduction
3.2k → 9.1kFollower Growth
1.4% → 4.3%Conversion Rate

Nikki T.

Boosted brand awareness with precision AI targeting

Challenge

Campaigns had low virality and poor audience targeting, limiting brand growth.

Solution

Used AI to analyze audience affinities and craft influencer partnerships that resonated with target demographics.

Key Results Achieved

120k → 310kAudience Impressions
3.1% → 8.6%Engagement Rate
$15k → $44kInfluencer ROI

Hear from the Brands Who Trust Us

CreloAI helped us launch influencer campaigns 5x faster. ROI predictions are spot on!

- Rohan Mehta

We now know exactly which creators will convert. It’s like having an in-house AI team.

- Anjali Singh

From strategy to execution in one dashboard — we’ve never moved this fast before.

- Vikram Desai

Frequently Asked Questions

See which creators match your brand

Tell us about your brand and get a free personalised creator shortlist.

"We now know exactly which creators drive revenue. It's like having an AI growth team."

No credit card. No commitment. Results in seconds.